Review





Similar Products

86
Sangon Biotech primer 3 plus
Primer 3 Plus, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+3/0+5+primer+software/pm42301356-71-9-16
Average 86 stars, based on 1 article reviews
primer 3 plus - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

94
OriGene ggtccaagtgatgctcaatggg
Ggtccaagtgatgctcaatggg, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+3/Cd38+Mouse+qPCR+Primer+Pair/pm42244013-162-8-13
Average 94 stars, based on 1 article reviews
ggtccaagtgatgctcaatggg - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

99
ATCC htb 30 oligonucleotides primers
Htb 30 Oligonucleotides Primers, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+3/SK-BR-3/pm42235512-174-164-158
Average 99 stars, based on 1 article reviews
htb 30 oligonucleotides primers - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

99
ATCC sfb 16s rdna gene primers 5 gacgctgaggcatgagagcat
Sfb 16s Rdna Gene Primers 5 Gacgctgaggcatgagagcat, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+3/16S/pm42185250-288-47-77
Average 99 stars, based on 1 article reviews
sfb 16s rdna gene primers 5 gacgctgaggcatgagagcat - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

98
TaKaRa 3 smart seq cds primer iia
3 Smart Seq Cds Primer Iia, supplied by TaKaRa, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+3/SMART-Seq+v4+PLUS+Kit/us12629681-230-13-22
Average 98 stars, based on 1 article reviews
3 smart seq cds primer iia - by Bioz Stars, 2026-08
98/100 stars
  Buy from Supplier

98
Complete Genomics Inc cpas barcode primer 3 kit
Cpas Barcode Primer 3 Kit, supplied by Complete Genomics Inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+3/CPAS+Barcode+Primer+3+Reagent+Kit/pmc13099500-264-23-28
Average 98 stars, based on 1 article reviews
cpas barcode primer 3 kit - by Bioz Stars, 2026-08
98/100 stars
  Buy from Supplier

86
Sangon Biotech primer cd44 r sequence 5 cattgtgggcaaggtgctatt 3
Primer Cd44 R Sequence 5 Cattgtgggcaaggtgctatt 3, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+3/cd44+sirna/pmc13018899-96-0-5
Average 86 stars, based on 1 article reviews
primer cd44 r sequence 5 cattgtgggcaaggtgctatt 3 - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Sangon Biotech primer krt15 r sequence 5 ccagggcacgtaccttgtc 3
Primer Krt15 R Sequence 5 Ccagggcacgtaccttgtc 3, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+3/primer+sequence/pmc13018899-98-0-5
Average 86 stars, based on 1 article reviews
primer krt15 r sequence 5 ccagggcacgtaccttgtc 3 - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Sangon Biotech primer cd44 f sequence 5 ctgccgctttgcaggtgta 3
Primer Cd44 F Sequence 5 Ctgccgctttgcaggtgta 3, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+3/cd44+sirna/pmc13018899-95-0-5
Average 86 stars, based on 1 article reviews
primer cd44 f sequence 5 ctgccgctttgcaggtgta 3 - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

Image Search Results